Sunday, April 26, 2009

Tentang Flu BABI (Swine Flu)

depkes.go.id

Seperti disampaikan Dirjen Pengendalian Penyakit dan Penyehatan Lingkungan (P2PL) Depkes, Prof. Dr. Tjandra Yoga Aditama, Sp.P., MARS., kepada para wartawan di Makassar tanggal 25 April 2009 saat berlangsungnya kegiatan simulasi penanggulangan episenter pandemi influenza.
Menurut Prof. Tjandra, penyakit flu babi adalah penyakit influenza yang disebabkan oleh virus influenza A subtipe H1N1 yang dapat ditularkan melalui binatang, terutama babi, dan ada kemungkinan penularan antar manusia.

Secara umum penyakit ini mirip dengan influenza (Influenza Like Illness-ILI)

Gejala Klinis : demam, batuk pilek, lesu, letih, nyeri tenggorokan, napas cepat atau sesak napas, mungkin disertai mual, muntah dan diare.

Virus H1N1 sebenarnya biasa ditemukan pada manusia dan hewan terutama babi tetapi keduanya memiliki karakteristik yang berbeda. Begitu juga dengan virus flu burung H5N1 meskipun sama-sama virus influenza tipe A.

Cara penularan : flu babi melalui udara dan dapat juga melalui kontak langsung dengan penderita.

Masa inkubasi: 3 sampai 5 hari.

Pencegahan Dan Kewaspadaan :
Masyarakat dihimbau untuk mewaspadai seperti halnya terhadap flu burung dengan menjaga perilaku hidup bersih dan sehat, menutup hidung dan mulut apabila bersin, mencuci tangan pakai sabun setelah beraktivitas, dan segera memeriksakan kesehatan apabila mengalami gejala flu.

DON'T TRY THIS AT HOME !



Semoga Bermanfaat

Friday, April 17, 2009

FLU SINGAPURA



FLU SINGAPURA - HFMD - KTM


"Flu Singapura" sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:

Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ).
Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.

GAMBARAN KLINIK :

Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :

o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.

Komplikasi penyakit ini adalah :

o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (KTM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10

LABORATORIUM :

Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Diagnosa Laboratorium adalah sebagai berikut :

1. Deteksi Virus :

o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.

2. Deteksi RNA :

RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)

3. Serodiagnosis :

Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

TATALAKSANA :

o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :

Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Extracorporeal membrane oxygenation.

o Pengobatan simptomatik :
Antiseptik didaerah mulut
Analgesik misal parasetamol
Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.

Hand-Foot-Mouth Disease (HFMD)

Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari

Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.

Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.

Diagnosis Banding : Varisela, herpes

Semoga Bermanfaat
(sumber:www.infeksi.com)

Cari Tahu Yang Lain...
Cara Menghindari Kanker !

TORCH Pada Kehamilan


Kolesterol ?

Friday, March 6, 2009

Secondhand Smoke



Definition of Secondhand Smoke


� Secondhand smoke, also known as environmental tobacco smoke, is a complex mixture of gases and particles that includes smoke from the burning cigarette, cigar, or pipe tip (sidestream smoke) and exhaled mainstream smoke.
� Secondhand smoke contains at least 250 chemicals known to be toxic, including more than 50 that can cause cancer.

Health Effects of Secondhand Smoke Exposure
� Secondhand smoke exposure causes heart disease and lung cancer in nonsmoking adults.
� Nonsmokers who are exposed to secondhand smoke at home or work increase their heart disease risk by 25�30% and their lung cancer risk by 20�30%.
� Breathing secondhand smoke has immediate harmful effects on the cardiovascular system that can increase the risk of heart attack. People who already have heart disease are at especially high risk.
� Secondhand smoke exposure causes respiratory symptoms in children and slows their lung growth.
� Secondhand smoke causes sudden infant death syndrome (SIDS), acute respiratory infections, ear problems, and more frequent and severe asthma attacks in children.
� There is no risk-free level of secondhand smoke exposure. Even brief exposure can be dangerous.

Current Estimates of Secondhand Smoke Exposure
� Exposure to nicotine and secondhand smoke is measured by testing the saliva, urine, or blood for the presence of a chemical called cotinine. Cotinine is a byproduct of nicotine metabolization, and tobacco is the only source of this marker.
� From 1988�91 to 2001�02, the proportion of nonsmokers with detectable levels cotinine was halved (from 88% to 43%).
� Over that same time period, cotinine levels in those who were exposed to secondhand smoke fell by 70%.
� More than 126 million nonsmoking Americans continue to be exposed to secondhand smoke in homes, vehicles, workplaces, and public places.
� Most exposure to tobacco smoke occurs in homes and workplaces.
� Almost 60% of U.S. children aged 3�11 years�or almost 22 million children�are exposed to secondhand smoke.
� About 25% of children aged 3�11 years live with at least one smoker, compared to only about 7% of nonsmoking adults.
� The California Environmental Protection Agency estimates that secondhand smoke exposure causes approximately 3,400 lung cancer deaths and 22,700�69,600 heart disease deaths annually among adult nonsmokers in the United States.
� Each year in the United States, secondhand smoke exposure is responsible for 150,000�300,000 new cases of bronchitis and pneumonia in children aged less than 18 months. This results in 7,500�15,000 hospitalizations, annually.

Monday, January 19, 2009

Radikal Bebas

Radikal Bebas

RADIKAL BEBAS ?

Apa itu Radikal Bebas dan Bahayanya
Radikal bebas merupakan suatu atom. molekul, atau senyawa yang mengandung satu atau lebih elektron yang tidak berpasangan sehingga sangat reaktif.

Pembentukan radikal bebas dalam tubuh :
? Pada waktu kita bernapas
(hasil samping proses oksidasi atau pembakaran)
? Olahraga yang berlebihan
? Jika terjadi peradangan
? Terpapar polusi Lingkungan
(asap rokok, kendaraan bermotor, radiasi, dll)
?dll

Pada saat terjadi infeksi, radikal diperlukan untuk membunuh mikroorganisme penyebab infeksi. Tetapi paparan radikal bebas yang berlebihan dan secara terus-menerus dapat menyebabkan kerusakan sel, mengurangi kemampuan sel untuk beradaptasi terhadap lingkungannya, dan para akhirnya dapat menyebabkan kematian sel. Radikal bebas bersifat reaktif, dapat menyebabkan kerusakan sel, mengurangi kemampuan adaptasi sel, bahwa kematian sel sehingga timbul gangguan / penyakit.

Penyakit yang disebabkan atau dikaitkan dengan radikal bebas :
? Kanker
? Aterosklerosis (penyempitan pembuluh darah)
? Penuan (Aging)
? Penyakit neurodegeneratif (Alzheimer Disease, Dementia/pikun, dll)
? Penyakit / gangguan paru, hati & ginjal
? Katarak, dll

Sistem Antioksidan Tubuh, Melawan Bahaya Radikal Bebas
Untuk memlawan bahaya radikal bebas, tubuh telah mempersiapkan penangkal yaitu dengan sistem antioksidan.Ada 3 golongan antioksidan dalam tubuh yaitu :
? Antioksidan Primer
Berfungsi mencegah pembentukan radikal bebas, misalnya Transferin, Feritin, albumin.
? Antioksidan Sekunder
Berfungsi menangkap radikal bebas dan menghentikan pembentukan radikal bebas, misalnya Superoxide Dismutase (SOD), Glutathion Peroxidase (GPx), Vitamin C, Vitamin E, B-Caroten, dll.
? Antioksidan Tersier atau repair enzyme
Berfungsi memperbaiki jaringan tubuh yang rusak oleh radikal bebas.
Pemeriksaan Status Antioksidan
saat ini telah tersedia pemeriksaan laboratorium untuk menilai sistem antioksidan tubuh yaitu :

? Status Antioksidan Total (SAT)
Merupakan pemeriksaan untuk mengukur kapasitas dan aktivitas total antioksidan yang terdapat dalam tubuh.
? Superoxide dismutase (SOD)
? Gluthatione Peroxidase (GPx)

Lakukan Pemeriksaan Status Antioksidan Total, SOD dan GPx

Mengapa kita perlu memeriksa Status Antioksidan ?
? Memberikan informasi tentang kapasitas status antioksidan seseorang.
? Untuk menilai daya tahan tubuh atau paerlindungan tubuh terhadap serangan radikal bebas.

Siapa saja yang perlu periksa Status Antioksidan ?
Mereka yang banyak terpapar polusi lingkungan atau mereka yang rentan taerhadap bahaya radikal bebas :
? Lanjut Usia
? Perokok
? Kegemukan
? Pasien Diabetes Melitus
? Penderita Hipertensi
? Penderita peradangan kronis, dll.

Kapan kita Memeriksa Status Antioksidan ?
? Untuk Skrining awal, yaitu sebelum dilakukan terapi dan sebelum pembelian suplemen antioksidan.
? Untuk monitoring (atau menilai hasil terapi), yaitu dilakukan setelah pemberian obat atau suplemen antioksidan.

Bagaimana kita dapat melakukan pemeriksaan Status Antioksidan ?
Untuk melakukan pemeriksaan Status Antioksidan diperlukan sampel darah dan tidak diperlukan persiapan khusus sebelumnya. Anda dapat melakukan pemeriksaan Status Antioksidan total, SOD, GPx di Laboratorium terdekat.

Paparan radikal bebas dapat menimbulkan berbagai penyakit, tetapi tubuh kita mempunyai sistem yuntuk menangkalnya yaitu dengan sistem antioksidan.
Dengan pemeriksaan status antioksigan tubuh, kita dapat mengetahui daya tahan tubuh terhadap radikal bebas, menentukan pelu tidaknya terapi atau suplemen antioksidan, dapat melakukan upaya untuk mencegah timbulnya penyakit yangnberkaitan dengan radikal bebas, dan memantau terapi / pemberian suplemen antioksidan.


Semoga Bermanfaat

Monday, October 27, 2008

CARA MENGHINDARI KANKER

CARA MENGHINDARI KANKER

Ada banyak cara untuk menghindari KANKER...

Apakah Kanker itu ?

Perkembangan kearah modernisasi menyebabkan terjadinya pergeseran jenis penyakit. Kalau dulu penyakit infeksi merupakan penyebab kematian terbanyak, kini penyakit akibat usia lanjut dan proses degenerasi semakin menonjol. Kematian karena penyakti jantung koroner dan stroke makin meningkat, dan penyakit tumor atau kanker merupakan salah satu penyakti degenerasi yang juga ditakuti. dikenal dua macam tumor, yaitu tumor jinak dan tumor ganasatau disebut dengan kanker. Tumor jinak tidak banyak mengganggu, dan pertumbuhannya lambat. Sebaliknya tumor ganas, karena pertumbuhannya sangat cepat dan tidak terkendali, maka ia akan sangat mengganggu, dapat menyebar ke organ-organ lain, dan menyebabkan kematian.

Di Amerika, ditemukan lebih dari 600.000 kasus kanker baru setiap tahunnya, atau sebanyaknya 1.600 orang per hari, dan satu dari lima orang Amerika meninggal karena kanker.

Kanker dapat timbul di semua tubuh manusia seperti payudara, leher rahim, kandungan, hati, lambung, usus besar, pankreas, paru-paru, prostat dan lain-lain. umunya penderita kanker yang datang memeriksakan diri ke dokter sudah dalam stadium lanjut, sehingga pengobatannya menjadi sangat sulit, apalagi bila sudah meyebar (metastase).

Kanker dapat diobati dengan sempurna bila penyakitnya ditemukan pada stadium dini.

Masalahnya adalah gejala kanker sendiri tidak nyata, keluhan penderita umumnya mirip dengan penyakti lain yang bukan keganasan, kecuali bila penyaktinya telah menjadi parah. Disinilah peran uji saring menjadi penting.

Siapakah yang dapat terkena KANKER?

Semua orang dapat terserang penyakit ini, tidak peduli kaya atau miskin, kulit putih atau hitam, gemuk atau kurus, laki-laki atau perumpuan, tetapi umumnya kanker lebih banyak menyerang orang berusia lanjut, yaitu antara 45-64 tahun, kecuali leukemia.

Telah terbukti bahwa adanya riwayat keluarga penderita kanker, seperti kanker payudara, usus besar dan kandungan, keturunannya akan mempunyai risiko tinggi untuk taerkena kanker tersebut.

Dalam lingkungan hidup kita di dunia modern ini, dengan adanya industrialisasi dan banyaknya makanan yang telah diproses terlebih dahulu, maka banyak sekali ditemukan zat-zat ataupun benda-benda yang berupakarsinogen yang dapat menyebabkan kanker. Contohnya : radiasi sinar X dan sinar ultraviolet dari matahari; zat-zat pengawet dan zat-zat pewarna; bahan-bahan kimia dari industri, seperi amin aromatik, asbes, ter (carbon hitam); asap hitam, alkohol dan obat-obatan. Begitu juga infeksi oleh virus dapat menyebabkan terjadinya kanker, seperti : virus hepatitis B dan C (kanker hati), virus Papiloma (kanker leher rahim), virus Eipstein Barr (kanker nasofaring), virus Sarcoma, virus AIDS dan lain-lain.

Apakah KANKER dapat dihindarkan ?

Menurut National Academy of Sciences di amerika, beberapa hal yang tersebut di bawah ini dapat dilakukan untuk menghindarkan kanker.
1. Kurangi lemak dalam makanan
2. Lebih banyak mengkonsumsi makanan yang mengandung serat, seperti sayur, buah-buahan, nasi.
3. lebih banyak mengkonsumsi makanan yang kaya akan beta karoten, seperti wortel, bayam, buah-buahan yang berwarna jingga.
4. Kurangi rokok dan makanan yang diawetkan, diasin atau diasap, baik daging maupun ikan.
5. Hindari sinar matahari dengan memakai topi dan lotion pelindung matahari.
6. Hindari berganti-ganti pasangan seksual.
7. Hindari alkohol.
8. Perhatian adanya perubahan yang mencurigakan di tubuh Anda, seperti adanya benjolan di payudara, di kulit atau adanya perubahan tahi lalat atau warna kulit, diare atau sembelit yang berkepanjangan dan lain-lain.
9. Deteksi dini kanker dengan pemeriksaan ujisaring, terutama untuk kelompok risiko tinggi seperti : pria diatas umur 50 tahun untuk kanker prostat, riwayat keluarga untuk kanker payudara, usus besar dan kandungan, wanita diatas 40 tahun untuk kanker leher rahim, pengidap hepatitis B atau C untuk kanker hati.

Uji saring KANKER

Pemeriksaan uji saring untuk deteksi dini penyakit kanker telah banyak dilakukan. Salah satu yang terkenal adalah Pap Smear,untuk deteksi dini adanya kanker leher rahim.

Pemeriksaan ujisaring lainnya adalah mamografi untuk deteksi kanker payudara, tetapi sayangnya alat mamografi tersebut hanya terdapat di kota-kota besar saja.

Akhir-akhir ini pemeriksaan Penanda Tumor di laboratorium klinik telah mulai banyak dan dianjurkan oleh para pakar dan peneliti.

Uji saring dengan pemeriksaann penanda tumor tidak dapat dilakukan secara massal, tetapi hanya bermanfaat bagi orang yang memiliki risiko tinggi.

Sebagai contoh :
* PSA (Prostate-Specific Antigen), untuk kanker prostat, bagi pria diatas umur 50 tahun, yang merupakan kelompok risiko tinggi untuk kanker prostat tersebut)
* Pemeriksaan Darah Samar untuk deteksi kanker usus besar atau kolorektal.
* Anti-EBV VCA lgA dan Anti-EBV EA lgA untuk kanker nasofaring, terutama bagi penduduk Asia Tenggara, dimana prevalensi kanker nasofaring cukup tinggi, khususnya pada ras Melayu, Cina, Dayak dan Kadazan.
* AFP (alfa-fetoprotein) untuk deteksi kanker hati, bagi pengidap hepatitis B dan C

Panel pemeriksaan Ujisaring TUMOR
* Pap Smear bagi wanita di atas 40 tahun.
* PSA bagi pria di atas 50 tahun
* AFP bagi pengidap hepatitis B atau C
* Anti-EBV VCA lgA dan
* Anti-EBV EA lgA bagi perokok, terutama ras Melayu, Cina, Dayak, dan Kadazan
* Darah Samar bagi orang dengan riwayat keluarga kanker kolorektal.
Semoga Bermanfaat

Monday, September 29, 2008

TORCH pada Kehamilan

TORCH pada Kehamilan

Infeksi Torch Pada Kehamilan
Berbahaya bagi janin
TORCH adalah istilah untuk menggambarkan gabungan dari empat jenis penyakit infeksi yaitu TOxoplasma, Rubella, Cytomegalovirus dan Herpes. Keempat jenis penyakti infeksi ini, sama-sama berbahaya bagi janin bila infeksi diderita oleh ibu hamil.

kini, diagnosis untuk penyakit infeksi telah berkembang antar lain ke arah pemeriksaan secara imunologis.
Prinsip dari pemeriksaan ini adalah deteksi adanya zat anti (antibodi) yang spesifik taerhadap kuman penyebab infeksi tersebut sebagai respon tubuh terhadap adanya benda asing (kuman. Antibodi yang terburuk dapat berupa Imunoglobulin M (IgM) dan Imunoglobulin G (IgG)

TOXOPLASMA

Infeksi Toxoplasma disebabkan oleh parasit yang disebut Toxoplasma gondi.
Pada umumnya, infeksi Toxoplasma terjadi tanpa disertai gejala yang spesipik. Kira-kira hanya 10-20% kasus infeksi

Toxoplasma yang disertai gejala ringan, mirip gejala influenza, bisa timbul rasa lelah, malaise, demam, dan umumnya tidak menimbulkan masalah.

Infeksi Toxoplasma berbahaya bila terjadi saat ibu sedang hamil atau pada orang dengan sistem kekebalan tubuh terganggu (misalnya penderita AIDS, pasien transpalasi organ yang mendapatkan obat penekan respon imun).

Jika wanita hamil terinfeksi Toxoplasma maka akibat yang dapat terjadi adalah abortus spontan atau keguguran (4%), lahir mati (3%) atau bayi menderita Toxoplasmosis bawaan. pada Toxoplasmosis bawaan, gejala dapat muncul setelah dewasa, misalnya kelinan mata dan atelinga, retardasi mental, kejang-kejang dn ensefalitis.

Diagnosis Toxoplasmosis secara klinis sukar ditentukan karena gejala-gejalanya tidak spesifik atau bahkan tidak menunjukkan gejala (sub klinik). Oleh karena itu, pemeriksaan laboratorium mutlak diperlukan untuk mendapatkan diagnosis yang tepat. Pemeriksaan yang lazim dilakukan adalah Anti-Toxoplasma IgG, IgM dan IgA, serta Aviditas Anti-Toxoplasma IgG.

Pemeriksaan tersebut perlu dilakukan pada orang yang diduga terinfeksi Toxoplasma, ibu-ibu sebelum atau selama masa hamil (bila hasilnya negatif pelu diulang sebulan sekali khususnya pada trimester pertma, selanjutnya tiap trimeter), serta bayi baru lahir dari ibu yang terinfeksi Toxoplasma.

RUBELLA

Infeksi Rubella ditandai dengan demam akut, ruam pada kulit dan pembesaran kelenjar getah bening. Infeksi ini disebabkan oleh virus Rubella, dapat menyerang anak-anak dan dewasa muda.

Infeksi Rubella berbahaya bila tejadi pada wanita hamil muda, karena dapat menyebabkan kelainan pada bayinya. Jika infeksi terjadi pada bulan pertama kehamilan maka risiko terjadinya kelainan adalah 50%, sedangkan jika infeksi tejadi trimester pertama maka risikonya menjadi 25% (menurut America College of Obstatrician and Gynecologists, 1981).

Tanda tanda dan gejala infeksi Rubella sangat bervariasi untuk tiap individu, bahkan pada beberapa pasien tidak dikenali, terutama apabila ruam merah tidak tampak. Oleh Karena itu, diagnosis infeksi Rubella yang tepat perlu ditegakkan dengan bantuan pemeriksaan laboratorium.

Pemeriksaan Laboratorium yang dilakukan meliputi pemeriksaan Anti-Rubella IgG dana IgM.

Pemeriksaan Anti-rubella IgG dapat digunakan untuk mendeteksi adanya kekebalan pada saat sebelum hamil. Jika ternyata belum memiliki kekebalan, dianjurkan untuk divaksinasi.

Pemeriksaan Anti-rubella IgG dan IgM terutama sangat berguna untuk diagnosis infeksi akut pada kehamilan <>CYTOMEGALOVIRUS (CMV)

Infeksi CMV disebabkan oleh virus Cytomegalo, dan virus ini temasuk golongan virus keluarga Herpes. Seperti halnya keluarga herpes lainnya, virus CMV dapat tinggal secara laten dalam tubuh dan CMV merupakan salah satu penyebab infeksi yang berbahaya bagi janin bila infeksi yang berbahaya bagi janin bila infeksi terjadi saat ibu sedang hamil.

Jika ibu hamil terinfeksi. maka janin yang dikandung mempunyai risiko tertular sehingga mengalami gangguan misalnya pembesaran hati, kuning, ekapuran otak, ketulian, retardasi mental, dan lain-lain.

Pemeriksaan laboratorium sangat bermanfaat untuk mengetahui infeksi akut atau infeski berulang, dimana infeksi akut mempunyai risiko yang lebih tinggi. Pemeriksaan laboratorium yang silakukan meliputi Anti CMV IgG dan IgM, serta Aviditas Anti-CMV IgG.

HERPES SIMPLEKS TIPE II

Infeksi herpes pada alat genital (kelamin) disebabkan oleh Virus Herpes Simpleks tipe II (HSV II). Virus ini dapat berada dalam bentuk laten, menjalar melalui serabut syaraf sensorik dan berdiam diganglion sistem syaraf otonom.

Bayi yang dilahirkan dari ibu yang terinfeksi HSV II biasanya memperlihatkan lepuh pada kuli, tetapi hal ini tidak selalu muncul sehingga mungkin tidak diketahui. Infeksi HSV II pada bayi yang baru lahir dapat berakibat fatal (Pada lebih dari 50 kasus)

Pemeriksaan laboratorium, yaitu Anti-HSV II IgG dan Igm sangat penting untuk mendeteksi secara dini terhadap kemungkinan terjadinya infeksi oleh HSV II dan mencaegah bahaya lebih lanjut pada bayi bila infeksi terjadi pada saat kehamilan.

Infeksi TORCH yang terjadi pada ibu hamil dapt membahayakan janin yang dikandungnya. Pada infeksi TORCH, gejala klinis yang ada searing sulit dibedakan dari penyakit lain karena gejalanya tidak spesifik. Walaupun ada yang memberi gejala ini tidak muncul sehingga menyulitkan dokter untuk melakukan diagnosis. Oleh karena itu, pemeriksaan laboratorium sangat diperlukan untuk membantu mengetahui infeksi TORCH agar dokter dapat memberikan penanganan atau terapi yang tepat.

Panel TORCH
? Anti Toxoplasma IgG dan IgM
? Anti Rubella IgG dan IgM
? Anti CMV IgG dan IgM
? Anti HSV II IgG dan IgM

www.infeksi.com
Semoga Bermanfaat

Friday, September 26, 2008

Polusi Udara dan Gangguan Jantung

Polusi Udara dan Gangguan Jantung

Polusi Udara Ganggu Jantung


Partikel super kecil yang ada pada polusi udara membahayakan pengidap jantung koroner. Mekanismenya, kemampuan jantung untuk mengantarkan sinyal elektrik terganggu. Demikian hasil studi tim peneliti dari Harvard University.
Polusi udara dari kendaraan bermotor dan industri telah terbukti memicu serangan jantung. Namun cara terjadinya belum diketahui secara pasti. "Peningkatan partikel lembut dari jalan raya serta karbon diperkirakan memberi dampak depresi level-ST segmen," jelas ketua tim peneliti Dr. Diane R. Gold, seorang pakar kesehatan lingkungan.
Dalam studi ini Gold dan rekan mengumpulkan data dari 48 pasien penyakit jantung koroner dari kawasan Boston. Pasien dimonitor selama 24 jam menggunakan mesin Electro Cardio Grafi portable. Alat ini memantau perubahan listrik jantung.
Gangguan irama jantung itu menunjukkan aliran darah ke jantung tak adekuat. Depresi level ST-segmen mungkin juga berarti radang otot jantung. Gold juga mencatat kadar polusi udara di Boston selama 24 jam.
Efeknya tampak paling besar pada kisaran bulan pertama setelah pasien rawat inap. Pada pengidap serangan jantung dan Diabetes, efeknya sudah terlihat sejak masih dalam perawatan di rumah sakit.
"Saya setuju. Pasien yang abru saja mengalami serangan jantung tak hanya perlu menghindari kepadatan lalu lintaskarena berisiko stres, Polusi udara pun perlu dihindari," tegas dr. Byron Lee, spesialis penyakit jantung dan pembuluh darah dari University of California, San Fransisco, Amerika serikat.
(Jawa Post, 24 September 2008)
Semoga Bermanfaat

Tuesday, September 23, 2008

KOLESTEROL ?

KOLESTEROL ?

Apa Itu Kolesterol?

Kata Kolesterol sudah sering kita dengar sehari-hari. Kata kolesterol sangat melekat dengan hal-hal seputar makanan yang lezat, berat badan yang berlebihan, usia, dan lain sebagainya. Kolesterol cenderung dikenal sebagai sesuatu yang negatif dan harus kita hindari.


Apa kolesterol sebenarnya?

Kolesterol adalah senyawa lemak kompleks, yang 80% dihasilkan dari dalam tubuh (organ hati) dan 20% sisanya dari luar tubuh (zat makanan) untuk bermacam-macam fungsi di dalam tubuh, antara lain membentuk dinding sel.

Kolesterol yang berada dalam zat makanan yang kita makan dapat meningkatkan kadar kolesterol dalam darah. Tetapi, sejauh pemasukan ini seimbang dengan kebutuhan, tubuh kita akan tetap sehat.

Kolesterol tidak larut dalam cairan darah, untuk itu agar dapat dikirim ke seluruh tubuh perlu dikemas bersama protein menjadi partikel yang disebut Lipoprotein, yang dapat dianggap sebagai �pembawa� (carier) kolesterol dalam darah


Apakah kolesterol berbahaya?

Kolesterol LDL (Low Density Lipoprotein)
Jenis kolesterol ini berbahaya sehingga sering disebut juga sebagai kolesterol jahat. Kolesterol LDL mengangkut kolesterol paling banyak didalam darah. Tingginya kadar LDL menyebabkankan pengendapan kolesterol dalam arteri. Kolesterol LDL merupakan faktor risiko utama penyakit jantung koroner sekaligus target utama dalam pengobatan.

Kolesterol HDL (High Density Lipoprotein).
Kolesterol ini tidak berbahaya. Kolesterol HDL mengangkut kolesterol lebih sedikit dari LDL dan sering disebut kolesterol baik karena dapat membuang kelebihan kolesterol jahat di pembuluh darah arteri kembali ke hati, untuk diproses dan dibuang. HDL mencegah kolesterol mengendap di arteri dan melindungi pembuluh darah dari proses Aterosklerosis (terbentuknya plak pada dinding pembuluh darah).
Trigliserida
Selain LDL dan HDL, yang penting untuk diketahui juga adalah Trigliserida, yaitu satu jenis lemak yang terdapat dalam darah dan berbagai organ dalam tubuh. Meningkatnya kadar trigliserida dalam darah juga dapat meningkatkan kadar kolesterol. Sejumlah faktor dapat mempengaruhi kadar trigliserida dalam darah seperti kegemukan, konsumsi alkohol, gula, dan makanan berlemak.

Tingginya kadar trigliserida (TG) dapat dikontrol dengan diet rendah karbohidrat.
(www.pedulikolesterol.com)
Semoga Bermanfaat
Migrain Pada Anak

Migrain Pada Anak

Tips

Kendalikan Migrain Pada Anak-Anak

Jika anak anda didiagnosis menderita migrain, cobalah ikuti saran dari American Academy of Family Physicians untuk mengatasinya.
  • Pastikan si buah hati makan tepat waktu dan tidak menyisakan hidangan yang anda siapkan.
  • Patuhi jadwal tidur anak.
  • Ajaklah anak berolahraga rutin setiap hari. Namun jangan memaksa anak melakukan olahraga yang berat.
  • Kenali pemicu migrain pada si kecil. Cobalah menghindari faktor pemicu tersebut. Beberapa faktor pemicu yang sering muncul adalah stres, terlalu banyak kegiatam, dan perubahan cuaca.
  • Hindari makanan pemicu migrain pada anak. Bahan makanan yang terkenal sebagai pemicu migrain pada anak antara lain, keju, daging olahan, cokelat, kafein, asinan, dan makanan yang banyak mengandung MSG.
(Jawa Pos, Minggu 10 Agustus 2008)

Monday, September 22, 2008

Sakit Kepala

Sakit Kepala

Bisa Sembuh dengan Cukup Istirahat
 Hampir tiap orang pernah merasakan sakit kepala (chepalgia). Keluhan tersebut ditandai dengan munculnya nyeri berdenyut pada kepala. Meski sensasi nyeri yang dirasakan seolah sama, sejatinya keluhan itu bermacam-macam. Ada nyeri kepala tipe tegang (NKTT), migrain, atau nyeri kepala Cluster.
�Tiga keluhan itu masuk kategori chepalgia primer,� Prof.Dr.dr. Mohammad Hasan Machfoed, MS.SpS(K), spesialis syaraf RSU. Dr. Soetomo.
Chepalgia primer merupakan keluhan nyeri kepala tanpa penyakit penyerta. Nyeri itu muncul akibat aktifitas yang mempengaruhi syaraf sehingga akhirnya muncul keluhan nyeri tersebut. Ada juga yang termasuk chepalgia sekunder. Ini nyeri kepala yang timbul sebagai salah satu gejala penyakit lain. Kanker otak misalnya.


Tiga jenis nyeri kepala yang termasuk kategori chepalgiaI primer (NKTT, migrain, dan cluster) muncul karena pemicu berberda. NKTT terjadi akibat ketegangan, baik karena tegang otot maupun tegang psikis. Tegang otot muncul lantaran aktifias fisik yang berat. Sedangkan ketegangan psikis akibat rasa cemas atau beban pikiran belebihan (stres atau depresi). Dua hal itu membuat otot kepala menjadi kaku dan kencang sehingga menekan saraf-saraf di kepala dan menyulut rasa nyeri.


NKTT berlangsung menyeluruh di semua bagian kepala (bilateral). Sensasi nyeri terasa menekan-nekan dengan intensitas ringan hingga berat. Namu, untuk menyembuhkannya bisa jadi tidak diperlukan obat. Cukup hilangkan ketegangnnya nyeri akan hilang dengan sendirinya. �Ketegangan fisik bisa dihilangkan dengan cukup istirahat�, saran Hasan.
Ketegangan psikis di sisi lain bisa diatasi dengan berpikir positif dan bersikap santai. NKTT merupakan nyeri kepala primer yang paling banyak diidap orang. Menurut Hasan, 90 persen serangan sakit kepala adalah NKTT.


Pada migrain, nyeri kepala terjadi hanya di satu sisi. Biasanya, rasa nyeri satu sisi ini berlangsung hebat. Terasa menekan-nekan, berdentang-dentang seolah dipukul genta. Begitu nyerinya, pengidap migarin kadang bisa nekat memukul-mukulkan kepala ke tembok.
Kualitas nyeri akan bertambah parah seieing dengan beratnya aktifitas fisik. Itu bisa berlangsung selama 30 menit hingga 7 hari. Selain nyeri migarin juga diserta dengan gejala lain. Misalnya fotofobia (fobia cahaya), dan fonofobia (fobia suara). Berbeda dengan NKTT, migrain tidak serta merta sembuh hanya dengan istirahat. �Rasa nyeri baru hilang setelah mengonsumsi obat,� imbuh Hasan.


Chepalgia Cluster nyaris mirip dengan migrain, terjadi di satu sisi terutama di seputar mata. Serangan nyeri ini diikuti dengan aktivitas saraf simptomatis. Karena itu ketika nyeri berlangsung, mata menjadi berair.
(Jawa Pos, 21 September 2008)